Tumor Biomarker Discovery: Methods and Protocols by Jian-Ying Zhang, Kok Sun Looi, Eng M. Tan (auth.), Michael

By Jian-Ying Zhang, Kok Sun Looi, Eng M. Tan (auth.), Michael A. Tainsky (eds.)

Through numerous mechanisms, melanoma cells give you the biomarker fabric that may result in their very own detection, which then promises clinicians the chance for non-invasive physique fluid and tissue research capable of point out the presence of tumors or the extent of tumor burden. In Tumor Biomarker Discovery: tools and Protocols, specialists within the box current distinct chapters fascinated about the use and improvement of panels of biomarker analytes whereas overlaying matters reminiscent of nucleic acids and protein-based applied sciences, metabolic profiling by way of analytic ability or spectroscopy, in addition to examine designs for biomarker discovery and validation. Written within the hugely winning Methods in Molecular Biology™ sequence layout, chapters comprise short introductions to the subjects, lists of the mandatory fabrics or reagents, step by step laboratory protocols, and notes on troubleshooting and averting recognized pitfalls.

Cutting-edge and authoritative, Tumor Biomarker Discovery: tools and Protocols is a perfect advisor to the applied sciences that may be used to find and validate tumor biomarker panels compatible for the presymptomatic early detection of cancer.

Show description

Read or Download Tumor Biomarker Discovery: Methods and Protocols PDF

Best biology books

Receptor Binding Techniques

Conserving the excessive criteria set by way of the winning first version, Anthony P. Davenport and a panel of hands-on researchers from the pharmaceutical and academia benefit from the newest advancements to supply unique useful equipment for learning receptors in silico, in vitro, and in vivo.

Angiogenesis: In Vitro Systems Part A

Angiogenesis is the expansion of recent blood vessels and is a crucial typical method within the physique. A fit physique keeps an ideal stability of angiogenesis modulators. in lots of severe sickness states, notwithstanding, the physique loses keep watch over over antiogenesis. illnesses which are angiogensis-dependent end result while blood vessels both develop excessively or insufficiently.

Systems Biology and Regulatory Genomics: Joint Annual RECOMB 2005 Satellite Workshops on Systems Biology and on Regulatory Genomics, San Diego, CA, USA; December 2-4, 2005, Revised Selected Papers

This publication constitutes the completely refereed post-proceedings of 2 joint RECOMB 2005 satellite tv for pc occasions: the 1st Annual Workshop on platforms Biology, RSB 2005 and the second one Annual Workshop on Regulatory Genomics, RRG 2005, held in San Diego, CA, united states in December 2005. The 21 revised complete papers provided have been rigorously reviewed and chosen for inclusion within the e-book.

Additional resources for Tumor Biomarker Discovery: Methods and Protocols

Sample text

Serological analysis of tumor antigens by recombinant cDNA expression cloning (SEREX) was developed by the group of Michael Pfreundschuh at the University of Saarland, Germany, in 1995 (2). org/CancerImmunomeDB) has been organized and lists more than 2,000 antigens (16). The SEREX approach includes the construction of cDNA libraries from fresh tumor specimens and cloning into lambda phage expression vectors. The recombinant phages are used to infect E. coli cells. Recombinant proteins expressed during lytic infection of the bacteria are replica-plated onto nitrocellulose membranes and immunoscreened with autologous serum.

Excess linkers and small cDNAs (< 300 bp) are removed by a gel filtration step as described in Novagen’s manual TB 247. Digestion of cDNAs with both HindIII and EcoRI thus yielded cDNA molecules ready for directional insertion into EcoRI/HindIII vector T7Select 10-3 arms. After vector ligation and packaging using T7 packaging extracts, the phages are plated to determine the library titer. About 50 phage 34 Chatterjee, Wojciechowski, and Tainsky clones are randomly picked up and PCR is performed with T7 forward primer (TCTTCGCCCAGAAGCTGCAG) and T7 reverse primer (CCTCCTTTCAGCAAAAAACCCC), to determine the insert sizes.

Proc. Natl Acad. Sci. U S A 97, 4198–203 16. , Hossfeld, D. , Zander, A. , Jungbluth, A. , Old, L. , and Kroger, N. (2007) Cancer-testis antigens are commonly expressed in multiple myeloma and induce systemic immunity following allogeneic stem cell transplantation. Blood 109, 1103–12 Chapter 3 Discovery of Antibody Biomarkers Using Protein Microarrays of Tumor Antigens Cloned in High Throughput Madhumita Chatterjee, Jerzy Wojciechowski, and Michael A. Tainsky Summary Development of humoral and cellular immunity against self-cellular proteins in cancer patients is a phenomenal observation.

Download PDF sample

Rated 4.61 of 5 – based on 47 votes